View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14026_low_10 (Length: 235)
Name: NF14026_low_10
Description: NF14026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14026_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 46872349 - 46872449
Alignment:
| Q |
1 |
ctcgagactcttgttacaacgttgtacaaacacatacactacaccaatttatgtttttaccttaaaacaacaaaatgcacgtttagtttaaattacactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46872349 |
ctcgagactcttgttacaacgttgtacaaacacaaacactacaccaatttatgtttttaccttaaaacaacaaaatgcacgtttagtttaaattacactc |
46872448 |
T |
 |
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
46872449 |
c |
46872449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University