View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14026_low_9 (Length: 237)
Name: NF14026_low_9
Description: NF14026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14026_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 37463168 - 37462957
Alignment:
| Q |
18 |
tccatgccacacctctccttaacctgcaaccaataccatgcaattatacacataacaaatcaaagttaatttaaatcacatataataacattgctgtaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37463168 |
tccatgccacacctctccttaacctgcaaccagtaccatgcaattatacacataacaaatcaaagttaatttaaatcacatataataacattgctgtaaa |
37463069 |
T |
 |
| Q |
118 |
taatttttacactactaattatttataatcgtcatatcataaaaatagtttatgttacgaaaggttcataacataccgcccgccatgccggcttcccagt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37463068 |
taatttttacactactaattaattataatcgtcatatcataaaaatagtttatgttacgaaaggttcataacataccgcccgccatgccggcttcccagt |
37462969 |
T |
 |
| Q |
218 |
ctgtgctcctcc |
229 |
Q |
| |
|
||||||| |||| |
|
|
| T |
37462968 |
ctgtgcttctcc |
37462957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University