View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14028_high_20 (Length: 267)

Name: NF14028_high_20
Description: NF14028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14028_high_20
NF14028_high_20
[»] chr2 (1 HSPs)
chr2 (16-267)||(8188419-8188670)


Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 8188419 - 8188670
Alignment:
16 aatgatgcagactttgagttagagcttcaggagttgctggacagtgatgctgacgagaatgcagcggtagaaacccgaaatgagtgtgatggtgctggac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8188419 aatgatgcagactttgagttagagcttcaggagttgctggacagtgatgctgacgagaatgcagcggtagaaacccgaaatgagtgtgatggtgctggac 8188518  T
116 gacgaccaaagactagacaaaataatcgccggaagagctcttcccaaagtgagagaaaaacattcggacaggttaacaggccactgcggcccattttgcc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8188519 gacgaccaaagactagacaaaataatcgccggaagagctcttcccaaagtgagagaaaaacattcggacaggttaacaggccactgcggcccattttgcc 8188618  T
216 ttgttggcttaatggacaacttgtttcagggaatggtttgatgcctgaagct 267  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
8188619 ttgttggcttaatggacaacttgtttcagggaatggtttgatgcctgaagct 8188670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University