View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14028_high_24 (Length: 231)
Name: NF14028_high_24
Description: NF14028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14028_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 4672556 - 4672331
Alignment:
| Q |
1 |
gtttagtttggtagtttatttacatgattgcttatagaatattgaattttttgttgaacatgactcatatttgctgataagtagcctgctatgaatcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4672556 |
gtttagtttggtagtttatttacatgattgcttatagaatattgaattttttgttgaacatgactcatatttgctgataagtagcctgctatgaatcaca |
4672457 |
T |
 |
| Q |
101 |
tacatgaacaccagacatgacacagacacgtcgatattggtaatagttttgaaaagggacataattgaatgtaatcacatttgtcggtgctacagcggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4672456 |
tacatgaacaccagacatgacacagacacgtcgatattggtaatag-tttgaaaagggacataattgaatgtaatcacatttgtcggtgctacagcggta |
4672358 |
T |
 |
| Q |
201 |
gccagtcaccaaagtgtcttccctttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4672357 |
gccagtcaccaaagtgtcttccctttg |
4672331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 189
Target Start/End: Complemental strand, 33770557 - 33770529
Alignment:
| Q |
161 |
ataattgaatgtaatcacatttgtcggtg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33770557 |
ataattgaatgtaatcacatttgtcggtg |
33770529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University