View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14028_low_25 (Length: 266)
Name: NF14028_low_25
Description: NF14028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14028_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 48541728 - 48541482
Alignment:
| Q |
1 |
ataggaaggaaaagatggagcttctaaatggattgtccataggaaaggttgatacttcaaacatttcacctcttcaacaggtaa-ctaaatgtgcaaccg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48541728 |
ataggaaggaaaagatggagcttctaaatggattgtccataggaaaggttgatacttcaaacatttcacctcttcaacaggtaaactaaatgtgcaaccg |
48541629 |
T |
 |
| Q |
100 |
tacgagtaaattaaatgtgtacttcaacagcagattaatttacattactcgtacatatccaggaagttctcgtattgtggggggaagatgacaatatatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48541628 |
tacgagtaaattaaatgtgtacttcaacagctgattaatttacattactcatacatatccaggaagttctcgtattgtggggggaagatgacaatatatt |
48541529 |
T |
 |
| Q |
200 |
tcccgtgcagatggctcatgaattgaaggagtatgtatccaaatcct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48541528 |
tcccgtgcagatggctcatgaattgaaggagtatgtatccaaatcct |
48541482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University