View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14028_low_26 (Length: 250)
Name: NF14028_low_26
Description: NF14028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14028_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 5685382 - 5685629
Alignment:
| Q |
1 |
cgagttagctatattcttctcacattgcgtaatttatttgacggggttagttagatatcatgtgaccggtctatgatcatttgatgtcactagccaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5685382 |
cgagttagctatattcttctcacattgcgtaatttatttgacggggttagttagatatcatgtgaccggtctatgatcatttgatgtcactagccaaact |
5685481 |
T |
|
| Q |
101 |
gaattgatttgttaggataaggattaaatataagcatttattctcatgaattaagcttgcatcgatatctcattattcatttgcataatatagttttatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685482 |
gaattgatttgttaggataaggattaaatataagcatttattctcatgaattaagcttgcatcgatatctcattattcatttgcataatatagttttatg |
5685581 |
T |
|
| Q |
201 |
tctatgtctcttggtatttggaatgatattaaaaatataatgtgtgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685582 |
tctatgtctcttggtatttggaatgatattaaaaatataatgtgtgat |
5685629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University