View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14029_high_15 (Length: 249)
Name: NF14029_high_15
Description: NF14029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14029_high_15 |
 |  |
|
| [»] chr1 (8 HSPs) |
 |  |
|
| [»] chr4 (10 HSPs) |
 |  |
|
| [»] chr7 (8 HSPs) |
 |  |
|
| [»] chr5 (5 HSPs) |
 |  |
|
| [»] scaffold0028 (2 HSPs) |
 |  |
|
| [»] chr2 (6 HSPs) |
 |  |
|
| [»] scaffold0076 (3 HSPs) |
 |  |
|
| [»] chr3 (6 HSPs) |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
| [»] scaffold0216 (1 HSPs) |
 |  |
|
| [»] scaffold0293 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 9111843 - 9111581
Alignment:
| Q |
7 |
aaaatatgttggaagtatatatgataataacatagtgctttttacgatggacaatagctgaagcacgctttttaccagaagcat---------------- |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9111843 |
aaaatatgttggaagtatatatgataataacacagtgctttttacgatggacaatagctgaagcacgctttttaccagaagcatacccaaaatatatact |
9111744 |
T |
 |
| Q |
91 |
----ttttagaatttgggaaacaattcttgatcagaaaataccacttttccaccaacacaaaaactctttctttcttcccaatttttcttcctggttacc |
186 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9111743 |
ttctttttagaatttgggaaacacttcttgatcagaaaataccacttttccaccaacacaaaaactctttctttcttcccaatttttcttcctggttacc |
9111644 |
T |
 |
| Q |
187 |
tctgatatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
9111643 |
tctgatatgatttatatcagtgaagaactgttgtatcctgggaagatatgcgcttatgaggcg |
9111581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 43254127 - 43254193
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||||||||||||| | ||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
43254127 |
acctctgatatgattcatatatgggaagaacatgttgtatcctgggaggatatgcgcttatgaggcg |
43254193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 1953708 - 1953764
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggc |
248 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
1953708 |
tatgattcataacagggaagaactgttgtatcctgggaggatattcgcttatgaggc |
1953764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 24981259 - 24981202
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
24981259 |
tatgattcataacggggaagaactgttgtatcctgggaggatatgtgcttatgaggcg |
24981202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 247
Target Start/End: Complemental strand, 38825583 - 38825519
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaact-gttgtattctgggaggatatgcgcttatgagg |
247 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
38825583 |
acctttgatatgattcatagcagagaagaacttgttgtatcctgggaggatatgcgtttatgagg |
38825519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 12141749 - 12141692
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
12141749 |
tatgattcataacggggaataattgttgtatcctgggaggatatgcgcttatgaggcg |
12141692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 246
Target Start/End: Complemental strand, 4242666 - 4242612
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgag |
246 |
Q |
| |
|
||||||||||| | | ||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
4242666 |
tatgattcataacggggaagaacagttgtatcctgggaggatatgcgctcatgag |
4242612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 249
Target Start/End: Complemental strand, 49387699 - 49387645
Alignment:
| Q |
196 |
attcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||| ||||| ||||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
49387699 |
attcacatcagggaagaacatgttgtatcctgggaggatatgcgcttataaggcg |
49387645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 4846023 - 4845943
Alignment:
| Q |
102 |
gggaaacaattcttgatcagaaaa-taccacttttccaccaacacaaaaactctttctttcttcccaatttttcttcctgg |
181 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4846023 |
gggagacacttcttgatcagaaaaataccacttttccaccaacacaaaagctctttctttcttcccaatttttcttcctgg |
4845943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 19697942 - 19697885
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19697942 |
tatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcg |
19697885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 247
Target Start/End: Complemental strand, 3835765 - 3835701
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaact-gttgtattctgggaggatatgcgcttatgagg |
247 |
Q |
| |
|
||||||||||||||| ||||||| |||||| | ||||||| ||| |||||||||||||||||||| |
|
|
| T |
3835765 |
acctctgatatgatttatatcagagaagaatttgttgtatcctgagaggatatgcgcttatgagg |
3835701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 6591930 - 6591889
Alignment:
| Q |
208 |
gaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
6591930 |
gaagaactgttgcatcctgggaggatatgcgcttatgaggcg |
6591889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 4846097 - 4846055
Alignment:
| Q |
20 |
agtatatatgataataacatagtgctttttacgatggacaata |
62 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
4846097 |
agtatatatgataataagatagtactttttacaatggacaata |
4846055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 14579631 - 14579697
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||| | ||||||||| |||| ||||||| |||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
14579631 |
acctcttacatgattcatgtcagagaagaacctgttgtatcctgagaggatattcgcttatgaggcg |
14579697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 249
Target Start/End: Complemental strand, 24045006 - 24044972
Alignment:
| Q |
215 |
tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
24045006 |
tgttgtatcctgggaggatatgcgcttatgaggcg |
24044972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 24041717 - 24041669
Alignment:
| Q |
202 |
atcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||| ||||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
24041717 |
atcagggaagaacatgttgtatcctaggaggatatgcgcttatgaggcg |
24041669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 41740029 - 41739972
Alignment:
| Q |
122 |
aaaataccacttttccaccaacacaaaaactctttctttcttcccaatttttcttcct |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41740029 |
aaaataccacttttccaccaacacaaaaactctttctttcttctcaatttttcttcct |
41739972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 1788996 - 1788939
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1788996 |
tatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcg |
1788939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 21185418 - 21185361
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | |||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
21185418 |
tatgattcataacggggaagaactattatatgctgggaggatatgcgcttatgaggcg |
21185361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 39655796 - 39655739
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39655796 |
tatgattcataacggagaagaactgttgtatcatgggaggatatgcacttatgaggcg |
39655739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 17028375 - 17028432
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | |||||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
17028375 |
tatgattcataacggggaagaactgtcatatcctgggaggatatgcgctaatgaggcg |
17028432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 17558811 - 17558868
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | |||||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
17558811 |
tatgattcataacggggaagaactgtcatatcctgggaggatatgcgctaatgaggcg |
17558868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 41740185 - 41740144
Alignment:
| Q |
10 |
atatgttggaagtatatatgataataacatagtgctttttac |
51 |
Q |
| |
|
||||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
41740185 |
atatgttgggaatatatatgataataacaaagtgctttttac |
41740144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 895455 - 895520
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
895455 |
acctctgatatgattcatattagggaagaacttttgtatcctgggaggatatgcgcttatgaggcg |
895520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 6667816 - 6667759
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6667816 |
tatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcg |
6667759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 44643473 - 44643530
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||| | ||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
44643473 |
tatgattcatatcggggaagaactgttgtatcctaggaggatatgcgcttatgaggcg |
44643530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 249
Target Start/End: Complemental strand, 31767553 - 31767487
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||| || |||||||||| |||||||||||| |
|
|
| T |
31767553 |
acctctgatgtgattcatatcagggaagaacatgttgtatcctaggaggatatgtgcttatgaggcg |
31767487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 895315 - 895367
Alignment:
| Q |
10 |
atatgttggaagtatatatgataataacatagtgctttttacgatggacaata |
62 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
895315 |
atatcttgggagtatatatgataataacatagtgttttttactatggacaata |
895367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 6671482 - 6671436
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcg |
238 |
Q |
| |
|
||||||||||| | | ||||||||||||||| ||||||||||||||| |
|
|
| T |
6671482 |
tatgattcataacggggaagaactgttgtatcctgggaggatatgcg |
6671436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 43287860 - 43287926
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| ||||||||||| | |||||| |||||||| |||| | ||||||||||||||||||| |
|
|
| T |
43287860 |
acctctgatgtgattcatatctgagaagaatatgttgtatcctggaaagatatgcgcttatgaggcg |
43287926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 185
Target Start/End: Original strand, 895382 - 895419
Alignment:
| Q |
148 |
aaactctttctttcttcccaatttttcttcctggttac |
185 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
895382 |
aaacactttctttcttcccaatttttcttcctagttac |
895419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 13010614 - 13010573
Alignment:
| Q |
208 |
gaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
13010614 |
gaagaactgttatatcctaggaggatatgcgcttatgaggcg |
13010573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 247
Target Start/End: Original strand, 4747204 - 4747264
Alignment:
| Q |
188 |
ctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgagg |
247 |
Q |
| |
|
||||||||||||||| || ||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
4747204 |
ctgatatgattcatacaagcgaagaacctgttgtatcttgggaggatatacgcttatgagg |
4747264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 15569578 - 15569644
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15569578 |
acctctgatatgattcatatcagagaagaacctgttgtatcctgggaggatatgtgcttatgaggcg |
15569644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 2609704 - 2609644
Alignment:
| Q |
187 |
tctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgag |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
2609704 |
tctgatatgattcatatcagagaagaacatgttgtatcctgcgaggatatgcgcttatgag |
2609644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 13815750 - 13815816
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| ||||||| || || ||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
13815750 |
acctctgatgtgattcacattagggaagaacatgttgtatcctgggaagatatgcgcttatgaggcg |
13815816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 249
Target Start/End: Complemental strand, 32352534 - 32352468
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| ||||||||||| | |||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
32352534 |
acctctgatgtgattcatatctgagaagaatatgttgtgtcctgggaggatatgcgcttatgaggcg |
32352468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 212 - 249
Target Start/End: Original strand, 11674041 - 11674078
Alignment:
| Q |
212 |
aactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11674041 |
aactgttgtatcctgggaggatatgcgcttatgaggcg |
11674078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 31206723 - 31206668
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgagg |
247 |
Q |
| |
|
||||||||||| | | ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
31206723 |
tatgattcataacggggaagaactgttgtatcctgccaggatatgcgcttatgagg |
31206668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 246
Target Start/End: Complemental strand, 39426548 - 39426494
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgag |
246 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
39426548 |
tatgattcataacagggaagaactgttttatcttgggaggatattcgcttatgag |
39426494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 31210172 - 31210115
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | |||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
31210172 |
tatgattcataacggggaagaactgttgtaccccgggaggatatgcacttatgaggcg |
31210115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 13291965 - 13292031
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
13291965 |
acctctgatatgattcatatcagagaataacctgttgtatcctgggaggatatgcgcttatgaggcg |
13292031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 39292120 - 39292176
Alignment:
| Q |
193 |
atgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39292120 |
atgattcataacggagaagaactgttgtattctggaaggatatgcgcttatgaggcg |
39292176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 18594835 - 18594892
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
18594835 |
tatgattcataacggggaagaactgttgtatcctgtgagaatatgcgcttatgaggcg |
18594892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 249
Target Start/End: Complemental strand, 26703113 - 26703057
Alignment:
| Q |
194 |
tgattcatatcagtgaagaact-gttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| ||| |||||||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
26703113 |
tgattcataccagagaagaacttgttgtatcttgggaggatatgcgtttatgaggcg |
26703057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 249
Target Start/End: Complemental strand, 26972846 - 26972790
Alignment:
| Q |
194 |
tgattcatatcagtgaagaact-gttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| ||| |||||||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
26972846 |
tgattcataccagagaagaacttgttgtatcttgggaggatatgcgtttatgaggcg |
26972790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 110133 - 110198
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
110133 |
acctctgacatgattcatatcagcgaagaactgttgtatcttgggaggatatgcgtttatgaggcg |
110198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 127712 - 127777
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
127712 |
acctctgacatgattcatatcagggaagaactgttgtatcatgggaggatatgcgtttctgaggcg |
127777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 2590521 - 2590578
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2590521 |
tatgattcataacggggaagaactgttgtatcctgggaggatatgcgcttatgaggcg |
2590578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 18739208 - 18739151
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
18739208 |
tatgattcataacggggaagaaccgttgtattgtgggaggatatgcgcttatgaggcg |
18739151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 21189422 - 21189479
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||| | | ||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
21189422 |
tatgattcataacggggaataactgttgtatccggggaggatatgcgcttatgaggcg |
21189479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 249
Target Start/End: Complemental strand, 27083183 - 27083129
Alignment:
| Q |
196 |
attcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||| || ||||||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27083183 |
attcatattagggaagaacctgttgtatcctgggaggatatgcgcttgtgaggcg |
27083129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 221 - 249
Target Start/End: Complemental strand, 10941492 - 10941464
Alignment:
| Q |
221 |
attctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10941492 |
attctgggaggatatgcgcttatgaggcg |
10941464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 221 - 249
Target Start/End: Complemental strand, 10947361 - 10947333
Alignment:
| Q |
221 |
attctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10947361 |
attctgggaggatatgcgcttatgaggcg |
10947333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 186 - 249
Target Start/End: Complemental strand, 6863 - 6800
Alignment:
| Q |
186 |
ctctgatatgattcatatcagtgaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
6863 |
ctctgatatgattcatatcagggaaaaactgttgtatcatggaaggatatgcacttatgaggcg |
6800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 111 - 164
Target Start/End: Complemental strand, 6964 - 6910
Alignment:
| Q |
111 |
ttcttgatcagaaaa-taccacttttccaccaacacaaaaactctttctttcttc |
164 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
6964 |
ttcttgatcagaaaaataccacttttccaccaacataaaaactctttttttcttc |
6910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 7062 - 7006
Alignment:
| Q |
33 |
ataacatagtgctttttacgatggacaatagctgaagcacgctttttaccagaagcat |
90 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
7062 |
ataagatagtgctttttacgatggacaataccagaagcacgc-ttttaccagaagcat |
7006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 2353208 - 2353274
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| |||||||| ||||||||||| || ||||||||||| |
|
|
| T |
2353208 |
acctcttatatgattcatatcagagaagaacctgttgtatcctgggaggataagcacttatgaggcg |
2353274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 249
Target Start/End: Complemental strand, 9372317 - 9372251
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||| |||||||||||||||| || |||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
9372317 |
acctctcatatgattcatatcagggatgaacctgttgtatcctgggacgatatgcgcttatgaggcg |
9372251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 249
Target Start/End: Complemental strand, 19930140 - 19930075
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||| |||||||| |||| ||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
19930140 |
acctctgatgtgattcatctcagggaagaacatgttgtat-ctgggaggatatgcgcttatgaggcg |
19930075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 76
Target Start/End: Complemental strand, 16366611 - 16366541
Alignment:
| Q |
7 |
aaaatatgttggaagtatatatgataataacatagtg-ctttttacgatggacaatagctgaagcacgctt |
76 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||| |||||||||||||||||| | |||||||||| |
|
|
| T |
16366611 |
aaaatatcttgggagtatatatgataataacgtagtgtttttttacgatggacaatacatcaagcacgctt |
16366541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 180
Target Start/End: Complemental strand, 16366540 - 16366508
Alignment:
| Q |
148 |
aaactctttctttcttcccaatttttcttcctg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16366540 |
aaactctttctttcttcccaatttttcttcctg |
16366508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 249
Target Start/End: Complemental strand, 26445198 - 26445133
Alignment:
| Q |
185 |
cctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| || ||||||| || |||||||||| |
|
|
| T |
26445198 |
cctctgatatgattcatatcagggaagaacatgttgtatcttgacaggatatacgattatgaggcg |
26445133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 208 - 249
Target Start/End: Original strand, 82658 - 82699
Alignment:
| Q |
208 |
gaagaactgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
82658 |
gaagaactgttgtatcctgggaggatatgcgcttatgaggcg |
82699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0216 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0216
Description:
Target: scaffold0216; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 12125 - 12191
Alignment:
| Q |
184 |
acctctgatatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggcg |
249 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| || ||| ||||||||||| ||||||| |
|
|
| T |
12125 |
acctctgatatgattcatataagggaagaacttgttgtatcctaggatgatatgcgcttgtgaggcg |
12191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0293 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0293
Description:
Target: scaffold0293; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 5022 - 4965
Alignment:
| Q |
192 |
tatgattcatatcagtgaagaac-tgttgtattctgggaggatatgcgcttatgaggc |
248 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
5022 |
tatgattcatatcatagaagaacctgttgtatcttgggaggatatgtgcttatgaggc |
4965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University