View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14029_low_14 (Length: 256)
Name: NF14029_low_14
Description: NF14029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14029_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 289075 - 288935
Alignment:
| Q |
16 |
aatactagatggcttaattgtttgatgtactgtaaaaatattagttgcatttgtactcatgtcctcggagagggtaacctagttgctgacgctttggcaa |
115 |
Q |
| |
|
||||| |||||| |||| ||||||| |||||||||||| |||| |||||||||||| ||||||||| |||||||||| | || ||||| || || || | |
|
|
| T |
289075 |
aataccagatggtttaactgtttgaggtactgtaaaaacattacttgcatttgtacacatgtcctcagagagggtaatttggtagctgatgcatttgcca |
288976 |
T |
 |
| Q |
116 |
agaatggccgagggctggctttgtactcttcacagcggtgg |
156 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||| ||||| |
|
|
| T |
288975 |
agaatggccaagggttggctttgtattcttcacagtggtgg |
288935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 21285811 - 21285866
Alignment:
| Q |
22 |
agatggcttaattgtttgatgtactgtaaaaatattagttgcatttgtactcatgt |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21285811 |
agatggcttaattgtttgatgtactgtaaaaatattagttgcatttgtactcatgt |
21285866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University