View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14029_low_9 (Length: 332)
Name: NF14029_low_9
Description: NF14029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14029_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 9e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 2694008 - 2693881
Alignment:
| Q |
18 |
atcaccgtaggtcaaaaggaggagtttattttttaaactctgcgactgtgtgagagttatttctttttggtggtcggaagctcaaaaactaggttttgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2694008 |
atcaccgtaggtcaaaaggaggagtttattttttaaactctgcgaccgtgtgagagttatttctttttggtggtcggaagctcaaaaactaggttttgat |
2693909 |
T |
 |
| Q |
118 |
tttgatattcatcaatggtgggttaagc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2693908 |
tttgatattcatcaatggtgggttaagc |
2693881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 262 - 316
Target Start/End: Complemental strand, 2693770 - 2693716
Alignment:
| Q |
262 |
aaagatatttatgaaatagtttttgaaaagggaaatgctatttaaagcaacagat |
316 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2693770 |
aaagacatttatgaaatagtttttgaaaagggaaatgctatttaaagcagcagat |
2693716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 241
Target Start/End: Complemental strand, 2693810 - 2693781
Alignment:
| Q |
212 |
atgcatcatacaaaatcatttatgaaatag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2693810 |
atgcatcatacaaaatcatttatgaaatag |
2693781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University