View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1402_high_7 (Length: 415)
Name: NF1402_high_7
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1402_high_7 |
 | |
|
| [»] scaffold0043 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 41297682 - 41297454
Alignment:
| Q |
13 |
aatatgttgtagcaatggaatcccaaactcctttggctgttgggaagcgaatgaaatatcccaccagcgaaggatccattgagtttatcagccgtccttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41297682 |
aatatgttgtagcaatggaatcccaaactcctttggctgttgggaagcgaatgaaatttcccaccagcgaaggatccattgagtttatcagccatccttt |
41297583 |
T |
|
| Q |
113 |
cactatggcattctcagtccgccatttacgaaatgtcggatcagttgctgacggttgagggaaggttccgttaatatatcccagtttgtctttaactgag |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
41297582 |
cactatggcattctcagtccgcaatttacaaaatgtcggatcagttgctgacggttgagggaaggttccgtcaatatatcccagtttgtctttgcctgag |
41297483 |
T |
|
| Q |
213 |
atgtacatcttagccacctgggaccataa |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
41297482 |
atgtacatctcagccacctgggaccataa |
41297454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 55954 - 55905
Alignment:
| Q |
189 |
tatcccagtttgtctttaactgagatgtacatcttagccacctgggacca |
238 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| | ||||||||||||| |
|
|
| T |
55954 |
tatcccagtttgtctttgcctgagatatacatctcaaccacctgggacca |
55905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University