View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1402_low_12 (Length: 380)
Name: NF1402_low_12
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1402_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 86 - 311
Target Start/End: Original strand, 2650729 - 2650952
Alignment:
| Q |
86 |
tgtttggtatcttttatgttgttcttatcttaacagagtgttaaatgctttttgttttggattttagatgttctgtgattggttgtttagagttaatagg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
2650729 |
tgtttggtatcttttatgttgttcttatcttaacagagtgttcaatgctttttgttttggattttagatgttctgtgattggttgtttagag-tcatagg |
2650827 |
T |
|
| Q |
186 |
attccctttgttttgtgtaattagctgttttgagtcatgggatttccttggtg-nnnnnnngttagtgccaaggttttaaacttataattagaattagag |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2650828 |
attccctttgttttgtgtaattagctgttttgagtcatgggatttccttggtgaaaaaaaagttagtgccaaggttttaaacttataattagaattagag |
2650927 |
T |
|
| Q |
285 |
atatctctctcaactatggttcaagtg |
311 |
Q |
| |
|
||| ||||| |||||||||||||||| |
|
|
| T |
2650928 |
ata--tctctgaactatggttcaagtg |
2650952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 336 - 374
Target Start/End: Original strand, 2651002 - 2651040
Alignment:
| Q |
336 |
tgttgagagatgaataattgtggttcaaatctctgctcc |
374 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
2651002 |
tgttgagaggtgaataattgtggttcaaatctgtgctcc |
2651040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 7 - 86
Target Start/End: Complemental strand, 10562844 - 10562764
Alignment:
| Q |
7 |
gtttatctatgttt-gtttaatgcaagaaatgttaactatttttgattgttatacataccatagttggtacctgtggctct |
86 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10562844 |
gtttatctatgttttgtttaatgcaagaaacgttaacttttcttgattgttatacataccatagttggtacctgtggctct |
10562764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University