View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1402_low_16 (Length: 365)
Name: NF1402_low_16
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1402_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 97 - 224
Target Start/End: Original strand, 40885617 - 40885744
Alignment:
| Q |
97 |
ataatgtaatttaattaatttattcagttgaacatatcctttttgggacaaagtttatcaacctcgagtttagaactttagacacaacattcagcaccat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885617 |
ataatgtaatttaattaatttattcagttaaacatatcctttttgagacagagtttatcaacctcgagtttagaactttagacacaacattcagcaccat |
40885716 |
T |
 |
| Q |
197 |
tctttgcggtatatgtgtaggtgaaccc |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40885717 |
actttgcggtatatgtgtaggtgaaccc |
40885744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 322 - 356
Target Start/End: Original strand, 40885845 - 40885879
Alignment:
| Q |
322 |
gtgcattcaattaagccacgtctcacctttcatct |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885845 |
gtgcattcaattaagccacgtctcacctttcatct |
40885879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University