View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1402_low_25 (Length: 284)
Name: NF1402_low_25
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1402_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 84 - 188
Target Start/End: Original strand, 8102818 - 8102922
Alignment:
| Q |
84 |
caaaggtgtgcaaaaagtgcttgaagggaagatattttgttcgtatccgtttctaagttggctttcaatttcaattgagagattttctcctttgtgaaat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8102818 |
caaaggtgtgcaaaaagtgcttgaagggaagatattttgttcgtacccgtttctaagttggctttcaatttcaattgagagattttctcctttgtgaaat |
8102917 |
T |
|
| Q |
184 |
gaaat |
188 |
Q |
| |
|
||||| |
|
|
| T |
8102918 |
gaaat |
8102922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 40147127 - 40147027
Alignment:
| Q |
84 |
caaaggtgtgcaaaaagtgcttgaagggaagatattttgttcgtatccgtttctaagttggctttcaatttcaattgagagattttctcctttgtgaaat |
183 |
Q |
| |
|
||||| |||| |||||||| ||| ||||| ||||||||||| ||| | | || | ||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
40147127 |
caaagatgtgtaaaaagtgattggagggatgatattttgttggtaccaatctccatgttggctttcaatttcagttgagcgattttctcctttgtgaaat |
40147028 |
T |
|
| Q |
184 |
g |
184 |
Q |
| |
|
| |
|
|
| T |
40147027 |
g |
40147027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University