View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1402_low_26 (Length: 277)
Name: NF1402_low_26
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1402_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 30 - 229
Target Start/End: Complemental strand, 43802387 - 43802188
Alignment:
| Q |
30 |
acaatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802387 |
acaatatccaagtaacttaactttgacaaatcattttcttctactaatttgttcgccccaaccacgttatctagctcttgttggagatttttcatcactc |
43802288 |
T |
|
| Q |
130 |
ttggatgcctcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802287 |
ttggatgcctcatgagctctgataaagcccactccacaaccgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
43802188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 30 - 229
Target Start/End: Complemental strand, 43812956 - 43812757
Alignment:
| Q |
30 |
acaatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactc |
129 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| || || |||||||| ||| |||||| || |||| ||||||||||||||||||||||| |||| |
|
|
| T |
43812956 |
acaatatctaagtaacttaactttgccatatcattctcctccactaatttgttcatcccaactacactatccagctcttgttggagatttttcattactc |
43812857 |
T |
|
| Q |
130 |
ttggatgcctcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
43812856 |
ttggatgcctcatgagctcggataaagcccactccacaatggttgcagaagtgtcaaatgccgcggcgatcatgtctaaggctatagcctttatgtttgt |
43812757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 114 - 163
Target Start/End: Complemental strand, 29944776 - 29944727
Alignment:
| Q |
114 |
agatttttcatcactcttggatgcctcatgagctctgataaagcccactc |
163 |
Q |
| |
|
|||||||||||||||||||||||||| | || || |||||||||||||| |
|
|
| T |
29944776 |
agatttttcatcactcttggatgccttaaaagttcggataaagcccactc |
29944727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University