View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1402_low_32 (Length: 265)
Name: NF1402_low_32
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1402_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 55694664 - 55694885
Alignment:
| Q |
1 |
caacattttccagtggatcaaacaaaaatattagtccaatggattataaacaacaaattagtgtagatctctttccctgtgtttatttttcataatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694664 |
caacattttccagtggatcaaacaaaaatattagtccaatggattataaacaacaaattagtgtagatctctttccctgtgtttatttttcataatccaa |
55694763 |
T |
 |
| Q |
101 |
aaaagatcaataatcaatttgctcttnnnnnnnttaattgattctactacattgtattattgttatttaaagcagaacttcaatcaaaaatatctatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| || ||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
55694764 |
aaaagatcaataatcaatttgctcttgaaaaaa-taattgattctactacattgtatttttattactagaagcagcacttcaatcaaaaatatctatcaa |
55694862 |
T |
 |
| Q |
201 |
gttatttgaagataagacatatg |
223 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
55694863 |
gttatttgaatataagacatatg |
55694885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University