View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_high_16 (Length: 459)
Name: NF14031_high_16
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 20 - 319
Target Start/End: Original strand, 54147076 - 54147373
Alignment:
| Q |
20 |
tgttcgtgattaggcttttctttgttctagtcaatccttttgttcgtccatgactattcaatatggtttgtttcttctttttctcatttaatttgctggt |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54147076 |
tgttcgtaattaggcttttctttgttctagtcaatccttttgttcgtccatgactattcaatatggtttgtttcttctttttctcatttaatttgctggt |
54147175 |
T |
|
| Q |
120 |
caaaattagttcctattggttgattagcatgttgcttttttgttttgattgggagaccgataaatttctaatggtgaaggtagtgtacctaagcataaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54147176 |
caaaattagttcctattggttgattagcatgttgctttt--gttttgattgggagaccgataaatttataatggtgaaggtagtgtacctaagcataaat |
54147273 |
T |
|
| Q |
220 |
tggttttttggtgcttgggagttagtaggcttcattgttgtgataacatggcattggtaactagtcttctcaatgtctgcaaaattgtgttggtctatga |
319 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54147274 |
tggttttttagtgcttgggagttagtaggcttcattgttgtgataacatggcattggtaactagtcttctcaatgtctacaaaattgtgttggtctatga |
54147373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 307
Target Start/End: Complemental strand, 24487524 - 24487454
Alignment:
| Q |
237 |
ggagttagtaggcttcattgttgtgataacatggcattggtaactagtcttctcaatgtctgcaaaattgt |
307 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| ||| ||| ||||||||||| |||||| |||||||| |
|
|
| T |
24487524 |
ggagttagtaggcttctttgttgtggcaacatgatatttgtatctagtcttctcgttgtctgtaaaattgt |
24487454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 24487600 - 24487555
Alignment:
| Q |
157 |
ttttgttttgattgggagaccgata-aatttctaatggtgaaggta |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
24487600 |
ttttgttttgattgggagaccgatagaatatctagtggtgaaggta |
24487555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University