View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_high_36 (Length: 298)
Name: NF14031_high_36
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 48412129 - 48411844
Alignment:
| Q |
1 |
ttgagtgttcacttgagttggaatctttgaatttggatccagaaaatattgcacgtgttgttcccggaaggataacccaaatgcggttttgcccttccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412129 |
ttgagtgttcacttgagttggaatctttgaatttggatccagaaaatattgcacgtgttgttcccggaaggataacccaaatgcggttttgcccttccaa |
48412030 |
T |
 |
| Q |
101 |
tgatgttaagatggtggcagcgggtaacaaattcggggatattgggttctggaatgttggagaaagtgagannnnnnngtatcatccacatcaggctcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48412029 |
tgatgttaagatggtggcagcgggtaacaaattcggtgatattgggttctggaatgttggagaaagtgagatttttttgtatcatccacatcaggctcct |
48411930 |
T |
 |
| Q |
201 |
atttctgggatcttgtttcaaccgcattgcttatcaaaggtttgtgaattcttaatctcgatttctgaatcagtttgttatttttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48411929 |
atttctgggatcttgtttcaaccgcattgcttatcaaaggtttgtgaattcttaatctcgatttctgaatcagtttgttatttttg |
48411844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 48418687 - 48418433
Alignment:
| Q |
1 |
ttgagtgttcacttgagttggaatctttgaatttggatccagaaaatattgcacgtgttgttcc---cggaaggataacccaaatgcggttttgcccttc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||| ||| | ||||| || |||| |||| ||||| |
|
|
| T |
48418687 |
ttgagtgttcacttgagttggaatctttgtctttggatcgtaaaaatatagcacgtgttgttcctgacggcggcataactcacttgcgatttttaccttc |
48418588 |
T |
 |
| Q |
98 |
caatgatgttaagatggtggcagcgggtaacaaattcggggatattgggttctggaatgttggagaaagtgagannnnnnngtatcatccacatcaggct |
197 |
Q |
| |
|
||||||| | |||||||| | ||| ||||||| | |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
48418587 |
caatgatttcaagatggtagtagccggtaacagagtcggggatattgggttctggaatgttggagaaagtgaggtttttgtgtaccatccacatcaggct |
48418488 |
T |
 |
| Q |
198 |
cctatttctgggatcttgtttcaaccgcattgcttatcaaaggtttgtgaattct |
252 |
Q |
| |
|
|| ||||||||||||| |||| || |||||||| |||||||| |||||||||| |
|
|
| T |
48418487 |
cccatttctgggatctccattcacccacattgcttgtcaaaggtgtgtgaattct |
48418433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University