View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14031_high_40 (Length: 274)

Name: NF14031_high_40
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14031_high_40
NF14031_high_40
[»] chr4 (2 HSPs)
chr4 (5-77)||(44270153-44270225)
chr4 (177-255)||(44269975-44270053)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 44270225 - 44270153
Alignment:
5 cacttcacatgcttcttagactcaaacaaatgatggattctaaggtttattaatcttccttatattgggttgc 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44270225 cacttcacatgcttcttagactcaaacaaatgatggattctaaggtttattaatcttccttatattgggttgc 44270153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 44270053 - 44269975
Alignment:
177 cctactttattgatgtgaagttggtttttctgtttgtgtgattaattgattgagcaagtttcgaactttacattttatt 255  Q
    ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||    
44270053 cctactttattgatgtgaagttggtttctctgtttgtgtgattaactgattgagcaagtttcgaactttacattttatt 44269975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University