View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_high_56 (Length: 217)
Name: NF14031_high_56
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_high_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 14 - 182
Target Start/End: Original strand, 36652718 - 36652897
Alignment:
| Q |
14 |
atgaaggagaaaacaaagtagtgttaccttgttcttacagatgttatttttcacatctaactctacgatgtgggactattctgcagttttgga------- |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36652718 |
atgaaggagaaaacaaagtagtgttaccttgttcttacagatgttatttttcgcatctaactctacgatgtgggacaattctgcagttttggaacaccat |
36652817 |
T |
 |
| Q |
107 |
----ggttattcatttctacatatatttcgtatctaactatacttactaacattgttgcaataatattaccgtgaaaaag |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36652818 |
atttggttattcatttctacatatatttcgtatctaactatacttactaacattgttgcaataatattaccgtgacaaag |
36652897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University