View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_35 (Length: 328)
Name: NF14031_low_35
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_35 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 13 - 328
Target Start/End: Complemental strand, 34195635 - 34195321
Alignment:
| Q |
13 |
aatatctttagtattcggagaatttaaaaaagtctttacaatgtcttaatgggtcttcagaatatacagtgcaattgactagtaatctgattgaggaagc |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34195635 |
aatatctttagtattcggagaatttaacaaagtctttacaatgtcttaatggg-cttcagaatatacagtgcaattgactagtaatctgattgaggaagc |
34195537 |
T |
 |
| Q |
113 |
gatattaggcgcagttgtcaattcgttatttccaacnnnnnnnctttattaaattatgatcactggtcttactttatttgggcatgaacttataataata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34195536 |
gatattaggcgcagttgtcaattcgttatttccaactttttttctttattaaattatgatcactggtcttactttatttgggcacgaacttataataata |
34195437 |
T |
 |
| Q |
213 |
tgctgctagcacttaatcaaattattagtaaaataggaccattggactggtattttatatcatatcataacactgaaaacaccatatatcaaccatttat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34195436 |
tgctgctagcacttaatcaaattattagtaaaataggaccattggactggtattttatatcatatcataacactgaaaacaccatatatcaaccatttat |
34195337 |
T |
 |
| Q |
313 |
cctattgttctcaatc |
328 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34195336 |
cctattgttctcaatc |
34195321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University