View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_37 (Length: 299)
Name: NF14031_low_37
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 59 - 283
Target Start/End: Original strand, 26538982 - 26539209
Alignment:
| Q |
59 |
tttagaccaactcatctaaactattttataataaaaaacagctgagagggtctctttgcagtaaatacaaagatgggattatccagtgaatttgattact |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
26538982 |
tttagaccaactcatctaaactattttataataaaaaatggctgagagggtctctttgcagtaaatacaaagatgggattatccaatgaatttgattatt |
26539081 |
T |
|
| Q |
159 |
aaagtaaaagaacaattttcttgttgcaattagagttagagaatgac--agagtattcaatcaataaaa-tgaaaaggaaatttaaaatttacggcagag |
255 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
26539082 |
aaggtaaaagaacaattttcttgttgcaattagagttagagaatgacagagagtattcaatcaataaaatttaaatcaaaatttaaaatttacggcagag |
26539181 |
T |
|
| Q |
256 |
tgaagtaaaatctgctacaaaggatagt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26539182 |
tgaagtaaaatctgctacaaaggatagt |
26539209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University