View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_43 (Length: 274)
Name: NF14031_low_43
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 44270225 - 44270153
Alignment:
| Q |
5 |
cacttcacatgcttcttagactcaaacaaatgatggattctaaggtttattaatcttccttatattgggttgc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44270225 |
cacttcacatgcttcttagactcaaacaaatgatggattctaaggtttattaatcttccttatattgggttgc |
44270153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 44270053 - 44269975
Alignment:
| Q |
177 |
cctactttattgatgtgaagttggtttttctgtttgtgtgattaattgattgagcaagtttcgaactttacattttatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44270053 |
cctactttattgatgtgaagttggtttctctgtttgtgtgattaactgattgagcaagtttcgaactttacattttatt |
44269975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University