View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14031_low_44 (Length: 271)

Name: NF14031_low_44
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14031_low_44
NF14031_low_44
[»] chr1 (1 HSPs)
chr1 (11-160)||(4196477-4196626)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 160
Target Start/End: Original strand, 4196477 - 4196626
Alignment:
11 taatactcatggatgaatgttccaattgagtgaagcttcgtaagaataataactgttttgcaaattgcttagatgcttagattcgattgctaattgtctt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4196477 taatactcatggatgaatgttccaattgagtgaagcttcgtaagaataataactgttttgcaaattgcttagatgcttagattcgattgctaattgtctt 4196576  T
111 agctgtttgcatgctgttgatactgataagaaaagaactattgatacttg 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
4196577 agctgtttgcatgctgttgatactgataagaaaagaactattgatacttg 4196626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University