View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_53 (Length: 241)
Name: NF14031_low_53
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 33524911 - 33524695
Alignment:
| Q |
7 |
tgttgctttgcaaattgcacttgtatagtggcaccttagatcttgcgcttaatgagtatgaaatattgaaatgtgttattattgtttaggtttttgtaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33524911 |
tgttgctttgcaaattgcacttgtatagtggcaccttagatcttgcgcttaatgagtatgaaatattgaaatgtgttattattgtttaggtttttgtaaa |
33524812 |
T |
|
| Q |
107 |
gataaaggagggaaataatgacagcttataatacagttatgctttagcctttatctagttgttatctttaactaggcctttcttcgattaattctcattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33524811 |
gataaaggagggaaataatgacagcttataatacagttatgctttagcctttatctagttgttatctttaactaggcctttcttcgattaattctcattg |
33524712 |
T |
|
| Q |
207 |
cactactttttggtccc |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33524711 |
cactactttttggtccc |
33524695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University