View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_54 (Length: 240)
Name: NF14031_low_54
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 25394821 - 25394617
Alignment:
| Q |
17 |
tactattaagatgatggagtagtattaattgaagtgaatccaaacacaaaatgacgcagtttcacgtgaaattaagagaggaattgttggtatacactat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25394821 |
tactattaagatgatggagtagtattaattgaagtgaatccaaacacaaaatgacgcagtttcacgtgaaattaagagaggaattgttggtatacactat |
25394722 |
T |
 |
| Q |
117 |
agaggttattatcaatatcagtagtgtctccatcttccatcccatactcctaattttccaccgtcaataatcttcttcttcttatgattccacctactac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25394721 |
agaggttattatcaatatcagtagtgtctccatcttccatcccatactcctaattttccaccgtcaataatcttcttcttcttatgattccacctactac |
25394622 |
T |
 |
| Q |
217 |
tagat |
221 |
Q |
| |
|
||||| |
|
|
| T |
25394621 |
tagat |
25394617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University