View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_56 (Length: 236)
Name: NF14031_low_56
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 27566930 - 27566726
Alignment:
| Q |
1 |
tcttgcccactcttgaaatgatttggagtgaccaaaatctgtatatggttttgaatatagtttgattgagctacattttttatttatttaaaaagaatat |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27566930 |
tcttgcccactcttgatatgatttggagtgaccaaaatctgtatatggttttgaatatagtttgattgagctacatttttt-tttatttaaaaagaatat |
27566832 |
T |
|
| Q |
101 |
ctcatcagattttttgtcaggtcttgacctgatgataagttatgtgggctgactaaggttgtcttgtctgtaaatattaccaatagcttggtgattttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27566831 |
ctcatcagattttttgtcaggtcttgacc---------------tgggctgactaaggttgtcttgtctgtaaatattaccaatagcttggtgattttga |
27566747 |
T |
|
| Q |
201 |
caaattaaagacataagaaga |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27566746 |
caaattaaagacataagaaga |
27566726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 22266208 - 22266256
Alignment:
| Q |
19 |
tgatttggagtgaccaaaatctgtatat-ggttttgaatatagtttgat |
66 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
22266208 |
tgatttggagtgaccaaaatctgtatttcggttttggatatagtttgat |
22266256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University