View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14031_low_58 (Length: 221)
Name: NF14031_low_58
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14031_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 26486149 - 26486242
Alignment:
| Q |
19 |
atctatttgatgcattattggaaatctacgtgtggatgattggtcattaatattggaaaaacctactacaattttcttactaatctactataga |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
26486149 |
atctatttgatgcattattggaattctacgtgtggatgattggtcattaatattggaataacctactacgattttcttactaatctactataga |
26486242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University