View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14032_low_6 (Length: 349)
Name: NF14032_low_6
Description: NF14032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14032_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 12 - 130
Target Start/End: Complemental strand, 21876957 - 21876840
Alignment:
| Q |
12 |
gtgagatgaatgttcaatgcacgataaattcgtatttataattagtttattgttaattttaaaagtactgcaacaatatatatattgaactcgaagaatt |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21876957 |
gtgagatgaatgttcaa-gcacgataaattcgtatttataattagtttattgttaattttaaaagtactgcaacaatatatatattgaacttgaagaatt |
21876859 |
T |
 |
| Q |
112 |
tatataaatcattcaaaat |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21876858 |
tatataaatcattcaaaat |
21876840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 253 - 327
Target Start/End: Complemental strand, 21876700 - 21876626
Alignment:
| Q |
253 |
agtctctcaaatcttctccttattaaattgaagcattatcctctcgctttaaactttttattttaacatgcaacg |
327 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21876700 |
agtctcacaaatcttctccttattaaattgaagcattatcctctcgctttaaactttttattttaacatgcaacg |
21876626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University