View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14032_low_9 (Length: 264)
Name: NF14032_low_9
Description: NF14032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14032_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 145
Target Start/End: Original strand, 576312 - 576443
Alignment:
| Q |
14 |
tttgagatctctagaattaaatttgactctttcaaaaaatggattcaaaaatacatttaacatcttactataatttttattgaaagaatatccttctgta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
576312 |
tttgagatctctagaattaaatttgactctttcaaaaaatggattcaaaaatacatttaacatcttactataatttttattgaaagaatatccttctgta |
576411 |
T |
 |
| Q |
114 |
ctttagagttttgatgaatatcagtatttggc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
576412 |
ctttagagttttgatgaatatcagtatttggc |
576443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 221 - 257
Target Start/End: Original strand, 576517 - 576553
Alignment:
| Q |
221 |
tgtatacattattcaattaaaactttccaagtattat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
576517 |
tgtatacattattcaattaaaactttccaagtattat |
576553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University