View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14033_high_11 (Length: 299)
Name: NF14033_high_11
Description: NF14033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14033_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 60 - 281
Target Start/End: Complemental strand, 25999039 - 25998818
Alignment:
| Q |
60 |
gttgttatgacttttctttaagacgttgttattatgacttatgagtgtcaaacatttgtcatttttactcatatttcaatatcaatcaatcataaggtac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25999039 |
gttgttatgacttttctttaagacgttgttattatgacttatgagtgtcaaacatttgtcatttttactcatatttcaatatcaatcaatcataaggtac |
25998940 |
T |
|
| Q |
160 |
ctggctaacaaacattttagagtgggtcccaagcatttattaacaaccagttaaatttcatatggctagaaattcatgctcatatagaacccaaaaaatg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25998939 |
ctggctaacaaacattttagagtgggtcccaagcatttattaacaaccagttaaattttatatggctagaaattcatgctcatatagaacccaaaaaatg |
25998840 |
T |
|
| Q |
260 |
attactttgggtaatttaggca |
281 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25998839 |
attactttgggtaatttaggca |
25998818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University