View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14033_low_12 (Length: 316)
Name: NF14033_low_12
Description: NF14033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14033_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 23 - 267
Target Start/End: Complemental strand, 31979916 - 31979672
Alignment:
| Q |
23 |
tacccttattggcaacaaatggaacctatacagtttcaaacaccacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979916 |
tacccttattggcaacaaatggaacctatacagtttcaaacaccacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgca |
31979817 |
T |
|
| Q |
123 |
atggttatgcttctggttttggtgcttcatcttcaactcctcactatgtcttctccaacaatgctgcttcttcttctgcttctcctcagtttgttgatgc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
31979816 |
atggttatgcttctggttttggtgcttcatcttccactcctcactatgttttctccaacaatgctgcttctgcttctacttctcctcagtttgttgatgc |
31979717 |
T |
|
| Q |
223 |
ttctgaccatgtcaatcttgatctcactcttcacctttgaaaaag |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979716 |
ttctgaccatgtcaatcttgatctcactcttcacctttgaaaaag |
31979672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University