View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14033_low_5 (Length: 571)
Name: NF14033_low_5
Description: NF14033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14033_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 525; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 525; E-Value: 0
Query Start/End: Original strand, 18 - 554
Target Start/End: Complemental strand, 48879889 - 48879353
Alignment:
| Q |
18 |
atgaatgctgtctcaaattttgatttttgtcgatccagggtgtttttactggcatttgtggaacagaacttgatcacggtgttgcagtggttggatatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879889 |
atgaatgctgtctcaaattttgatttttgtcgatccagggtgtttttactggcatttgtggaacagaacttgatcacggtgttgcagtggttggatatgg |
48879790 |
T |
 |
| Q |
118 |
aacagagaacgggatcgattactggttagtgaggaactcatggggttcatcatggggtgaaaatggctacattaagatggagagaaatttgttaacaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879789 |
aacagagaacgggatcgattactggttagtgaggaactcatggggttcatcatggggtgaaaatggctacattaagatggagagaaatttgttaacaaaa |
48879690 |
T |
 |
| Q |
218 |
gaaactggcaagtgtggaattgcaatggaggcatcctatcctatcaagaagggtcagaacccaccaaatcctggtccttcacctccatcacctgttcagc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879689 |
gaaactggcaagtgtggaattgcaatggaggcatcatatcctatcaagaagggtcagaacccaccaaatcctggtccttcacctccatcacctgttcagc |
48879590 |
T |
 |
| Q |
318 |
cttcaactgtatgtgatgaatactactcttgctcagctggaaccacatgttgttgcctttttgagtatggaaacttctgctttgcttggggatgctgccc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879589 |
cttcaactgtatgtgatgaatactactcttgctcagctggaaccacatgttgttgcctttttgagtatggaaacttctgctttgcttggggatgctgccc |
48879490 |
T |
 |
| Q |
418 |
tattgagtctgcaacttgctgcgacgacggttccagctgttgccctcatgactacccggtctgcgatgttgaagctggaacttgccgattggtaattatc |
517 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879489 |
tattgagtctgcaacttgctgcgatgacggttccagctgttgccctcatgactacccggtctgcgatgttgaagctggaacttgccgattggtaattatc |
48879390 |
T |
 |
| Q |
518 |
ttatttcttccttaagtctatttctattacaaataag |
554 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48879389 |
ttatttcttccttaagtctatttctattacagataag |
48879353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 236 - 276
Target Start/End: Original strand, 24743655 - 24743695
Alignment:
| Q |
236 |
attgcaatggaggcatcctatcctatcaagaagggtcagaa |
276 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
24743655 |
attgcaatggagccatcatatcctatcaagaatggtcagaa |
24743695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University