View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_33 (Length: 313)
Name: NF14034_high_33
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 48153957 - 48154238
Alignment:
| Q |
1 |
aagggactccaagccaccgatgcagataccgccgatgaaagcagccggagtgagagagtgatcggaggtggtggggacggcggggatctcgttgtcatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153957 |
aagggactccaagccaccgatgcagataccgccgatgaaagcagcgggagtgagagagtgatcggaggtggtggggacggcggggatctcgttgtcatcc |
48154056 |
T |
 |
| Q |
101 |
aattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaagatgatgacagggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154057 |
aattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaagatgatgacagggt |
48154156 |
T |
 |
| Q |
201 |
gttctgatatgaggcggttgattcgagtttctatggattcgtctatgtccatggatagagaagatgaagagggtgagttgga |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154157 |
gttctgatatgaggcggttgattcgagtttctgtggattcgtctatgtccatggatagagaagatgaagagggtgagttgga |
48154238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 85 - 232
Target Start/End: Complemental strand, 4109427 - 4109283
Alignment:
| Q |
85 |
gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtg |
184 |
Q |
| |
|
|||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| |||||||||| | ||||| || ||| |
|
|
| T |
4109427 |
gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagc---aagaggaacgtgtg |
4109331 |
T |
 |
| Q |
185 |
aagatgatgacagggtgttctgatatgaggcggttgattcgagtttct |
232 |
Q |
| |
|
|||||||| || || |||||||||||||| |||| ||| || |||||| |
|
|
| T |
4109330 |
aagatgataactggatgttctgatatgagacggtggatgcgtgtttct |
4109283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University