View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_61 (Length: 247)
Name: NF14034_high_61
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 37288593 - 37288752
Alignment:
| Q |
20 |
tcaccttgattggtttatatatatatggcttcatcataatttatttataagctcatatttaatacatgaaataaagtctttgatcatgctcacggcttan |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37288593 |
tcaccttgattggtttata----tatggcttcatcataatttatttataagctcatatttaatacatgaaataaagtctttgatcatgctcatggcttat |
37288688 |
T |
 |
| Q |
120 |
nnnnnnatatccaagtatgtcggtatctaagttttcaagtctaaaatttcttattctatgatatg |
184 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37288689 |
ttttttatatccaagtatgtc-gtatctaagttttcaagtctaaaatttcttattctatgatatg |
37288752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University