View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_70 (Length: 233)
Name: NF14034_high_70
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 146 - 218
Target Start/End: Original strand, 31035053 - 31035121
Alignment:
| Q |
146 |
tccttactgataagctaagttgtacatctcactcaagtctcaactatatatttattaaaactcttactagtat |
218 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31035053 |
tccttacttataagctaagttgtgcatctca----agtctcaactatatatttattaaaactcttactggtat |
31035121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University