View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14034_high_76 (Length: 221)

Name: NF14034_high_76
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14034_high_76
NF14034_high_76
[»] chr8 (1 HSPs)
chr8 (71-125)||(37464955-37465009)


Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 71 - 125
Target Start/End: Original strand, 37464955 - 37465009
Alignment:
71 caattttgtcaacaaagatttgcaagtgtcacgagctaccgtcgagcaacagttg 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37464955 caattttgtcaacaaagatttgcaagtgtcacgagctaccgtcgagcaacagttg 37465009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University