View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_77 (Length: 218)
Name: NF14034_high_77
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_77 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 6 - 218
Target Start/End: Complemental strand, 54989346 - 54989134
Alignment:
| Q |
6 |
ataaatatcaactgcagctgcatgcgataggataatattatgggctgctacaaagggatccttcttggaatcgccctcgctacaatttccaaatttgccg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54989346 |
ataaatatcaactgcagctgcatgcgataggataatattatgggctgctacaaagggatccttctcggaatcgccctcgctacaatttccaaatttgccg |
54989247 |
T |
|
| Q |
106 |
gagcagcggcatggcgggggtttgccttttcggtaacctagtggaaattggagatttggttcattgaatgtgggcccgtactttactctgtcacccaagg |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||| || |||||| ||||||||||| |||| |
|
|
| T |
54989246 |
gagcagcggcatggcgggtgtttgccttttcggtaacctagtgaaacttggagatttggttcattgaatgtggtccagtacttaactctgtcaccaaagg |
54989147 |
T |
|
| Q |
206 |
atttaaaacatat |
218 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54989146 |
atttaaaacatat |
54989134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 55002870 - 55002812
Alignment:
| Q |
10 |
atatcaactgcagctgcatgcgataggataatattatgggctgctacaaagggatcctt |
68 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55002870 |
atatcaactgcagctgcatgtgacaggataatattatgggctgctacaaagggctcctt |
55002812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University