View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_78 (Length: 217)
Name: NF14034_high_78
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_78 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 174
Target Start/End: Original strand, 978660 - 978812
Alignment:
| Q |
22 |
cttgattgttggcttgttcttcattggaggttgaaccaggttcttgattgtttccaaaggtgaagtatggtatctcaattctctgaatcttttgaggtct |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
978660 |
cttgattgttggcttgttctccattggaggttgaaccaggttcttgcttgtttccaaaggtgaagtatggtatctcaattctctgaatcttttgaggtct |
978759 |
T |
 |
| Q |
122 |
ttgtatattattgtttctgggatccaattgatcaggactggagacattgctga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
978760 |
ttgtatattattgtttctgggatccaattgattaggattggagacattgctga |
978812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University