View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14034_high_78 (Length: 217)

Name: NF14034_high_78
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14034_high_78
NF14034_high_78
[»] chr7 (1 HSPs)
chr7 (22-174)||(978660-978812)


Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 174
Target Start/End: Original strand, 978660 - 978812
Alignment:
22 cttgattgttggcttgttcttcattggaggttgaaccaggttcttgattgtttccaaaggtgaagtatggtatctcaattctctgaatcttttgaggtct 121  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
978660 cttgattgttggcttgttctccattggaggttgaaccaggttcttgcttgtttccaaaggtgaagtatggtatctcaattctctgaatcttttgaggtct 978759  T
122 ttgtatattattgtttctgggatccaattgatcaggactggagacattgctga 174  Q
    |||||||||||||||||||||||||||||||| |||| |||||||||||||||    
978760 ttgtatattattgtttctgggatccaattgattaggattggagacattgctga 978812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University