View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_85 (Length: 211)
Name: NF14034_high_85
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_85 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 16 - 177
Target Start/End: Complemental strand, 13895556 - 13895395
Alignment:
| Q |
16 |
atgaaagggaataaaggacgtcatatggttttaatgtgtttagttgctacaacagaactgatggcattgtgtttttgaccggctgtagtggccaaacatt |
115 |
Q |
| |
|
||||||| ||||| || | ||||||||||||| | ||| |||||| |||||||||| ||||| |||||||||||| ||||||||||||||| |||| | | |
|
|
| T |
13895556 |
atgaaagagaatagagaatgtcatatggttttgacgtgcttagttactacaacagacctgattgcattgtgttttcgaccggctgtagtggacaaatagt |
13895457 |
T |
|
| Q |
116 |
ggctgctacagtgaaactgttgtaaatccgaatatgccgtcaatatataagaattacctgtg |
177 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||| |||| || |||||||| |||||| |
|
|
| T |
13895456 |
ggctgctacggtgaaactgttgtacatccgaatatgccatcaacatgtaagaattccctgtg |
13895395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 13864648 - 13864586
Alignment:
| Q |
115 |
tggctgctacagtgaaactgttgtaaatccgaatatgccgtcaatatataagaattacctgtg |
177 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
13864648 |
tggctgctacggtgaaactgttgtaaatccgaatatgccatcaacatataagaattccctgtg |
13864586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 13864727 - 13864643
Alignment:
| Q |
16 |
atgaaagggaataaaggacgtcatatggttttaatgtgtttagttgctacaacagaactgatggcattgtgtttttgaccggctg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| ||| |||||||||||| |||| | ||| || |||| |||||||| ||||| |
|
|
| T |
13864727 |
atgaaagggaatagaggacgtcatatgggtttaacgtgcttagttgctacagcagacccgattgccttgtatttttgactggctg |
13864643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University