View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_high_86 (Length: 206)
Name: NF14034_high_86
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_high_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 39682262 - 39682436
Alignment:
| Q |
18 |
agggaggatagagatgaggaagagggccattaacagcaacacaattcttgccatgatgattagcaatgaatttggataccaagatgaatgaaaa--agag |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39682262 |
agggaggatagagatgagggagagggccattaacagcaacacaattcttgccatgatgattagcaatgaatttggataccaagatgaatgaaaaagagag |
39682361 |
T |
 |
| Q |
116 |
aggaggagagaactacttgagttgagacttgagggaggtttggctaaatatattttttagtgcgcgcgtcttgtg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39682362 |
aggaggagagaactacttgagttgagacttgagggaggtttggctaaatatattttttagtgcgcgcgtcttgtg |
39682436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University