View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_46 (Length: 277)
Name: NF14034_low_46
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 33673515 - 33673748
Alignment:
| Q |
11 |
ttatacttattaaatacaaatgagtttgtagtcaatgcttagttctcactttgaatacaagtgagttttgttatacaccaagttttgttacgatgtggtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33673515 |
ttatacttattaaatacaaatgagtttgtagtcaatgcttagttctcactttgaatacaagtgagttttgttatacaccaagttttgttacgatgtggtt |
33673614 |
T |
|
| Q |
111 |
tgcattacaattgattgatatatgttgttaagatgtctcgctgtactcaggatttagtagcagttatacttcacctaattttctaaaaagttctggttat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33673615 |
tgcattacaattgattgatatatgttgttaagatgtctcgttgtactcaggatttagtagcagttatacttcacctaattttctaaaaagttctggttat |
33673714 |
T |
|
| Q |
211 |
tgatcttaaatgccatcaatctgcattagttgtg |
244 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
33673715 |
tgatcttaaatgccatcaatctgcagtagttgtg |
33673748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University