View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_47 (Length: 276)
Name: NF14034_low_47
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 32268534 - 32268285
Alignment:
| Q |
19 |
tgtatagccctccaccacaatttcatgacaaacaacattatcaatatttaatttcttacccttaaactcatctatcaaactctcatccaacatattctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268534 |
tgtatagccctccaccacaatttcatgacaaacaacattatcaatatttaatttcttacccttaaactcatctatcaaactctcatccaacatattctct |
32268435 |
T |
|
| Q |
119 |
aatgtttcatcttcttcttcaccatcatcaattttaaatttaacatcacctgaattattaatattgttttcattgttatgaacgatgaaacaaaataatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268434 |
aatgtttcatcttcttcttcaccatcatcaattttaaatttaacatcacctgaattattaatattgttttcattgttatgaacgatgaaacaaaataatg |
32268335 |
T |
|
| Q |
219 |
tgacactcgtatttggacggtccaacattctaatacccaatgcctatgct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32268334 |
tgacactcgtatttggacggtccaacattctaatacccaatgccaatgct |
32268285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University