View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_55 (Length: 254)
Name: NF14034_low_55
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_55 |
 |  |
|
| [»] scaffold0054 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 5403319 - 5403568
Alignment:
| Q |
1 |
tagtcatattttagatggattggat-------gtgtacctatcctaagtaggggtgtacaaaaatgtgattaacttgaattgtatccataaactatttaa |
93 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5403319 |
tagtcatattttagatggattggatactaaatgtgtacatatcctaagtaggggtgtgcaaaaatgtgattaact-gaattgtatccataaactatttaa |
5403417 |
T |
 |
| Q |
94 |
tatggtgtaannnnnnngtggttcagtttgattcaatttatggatacaattcagtcaaccacatttttacacacctctgcttatttttaccggtttaacg |
193 |
Q |
| |
|
||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||| ||| | | | | ||||||||| ||| ||| |
|
|
| T |
5403418 |
tatggtgcaatttttttgtggttcaatttgattcaatttatggatacaattcagtcaaccacatttttgcac-cttaggataatttttacccgttcaaca |
5403516 |
T |
 |
| Q |
194 |
aaatattttttcacagccaaattagagtgtaataaaatgtagtataatttac |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5403517 |
aaatattttttcacagccaaattagagagtaataaaatgtagtataatttac |
5403568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 168
Target Start/End: Complemental strand, 39605586 - 39605536
Alignment:
| Q |
118 |
agtttgattcaatttatggatacaattcagtcaaccacatttttacacacc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
39605586 |
agtttgattcaatttatggatacaattcagttaaccatatttttgcacacc |
39605536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 111 - 166
Target Start/End: Complemental strand, 35704327 - 35704272
Alignment:
| Q |
111 |
gtggttcagtttgattcaatttatggatacaattcagtcaaccacatttttacaca |
166 |
Q |
| |
|
||||| || ||||||||| ||||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
35704327 |
gtggtccaatttgattcagtttatagatacaattcagttaaccacatttttgcaca |
35704272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 115 - 168
Target Start/End: Original strand, 35149 - 35202
Alignment:
| Q |
115 |
ttcagtttgattcaatttatggatacaattcagtcaaccacatttttacacacc |
168 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
35149 |
ttcagtttggttcagtttatggatacaattcagttaaccacatttttgcacacc |
35202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 35207 - 35162
Alignment:
| Q |
41 |
gtaggggtgtacaaaaatgtgattaacttgaattgtatccataaact |
87 |
Q |
| |
|
|||||||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
35207 |
gtaggggtgtgcaaaaatgtggttaact-gaattgtatccataaact |
35162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 19534359 - 19534302
Alignment:
| Q |
111 |
gtggttcagtttgattcaatttatggatacaattcagtcaaccacatttttacacacc |
168 |
Q |
| |
|
||||| ||||||| |||| |||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
19534359 |
gtggtccagtttggttcagcttatggatacaattcagttaaccacatttttgcacacc |
19534302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 22024108 - 22024051
Alignment:
| Q |
111 |
gtggttcagtttgattcaatttatggatacaattcagtcaaccacatttttacacacc |
168 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| ||| |||||||||||| |||||| |
|
|
| T |
22024108 |
gtggttcagtttggttcagtttatgaatacaattgagttaaccacatttttgcacacc |
22024051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 117 - 168
Target Start/End: Complemental strand, 27293559 - 27293508
Alignment:
| Q |
117 |
cagtttgattcaatttatggatacaattcagtcaaccacatttttacacacc |
168 |
Q |
| |
|
|||||||||||| | ||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
27293559 |
cagtttgattcagtgtatggatgcaattcagttaaccatatttttacacacc |
27293508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University