View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_61 (Length: 248)
Name: NF14034_low_61
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 237
Target Start/End: Original strand, 24830979 - 24831206
Alignment:
| Q |
10 |
atgaatcattatttgctctcattttgcatgcatgtaaaatgaaatgtacacagagacatccaattcgtatcatatagatccatggaatgaagctgagcct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24830979 |
atgaatcattatttgctctcattttgcatgcatgtaaaatgaaatgtacacagagacatccaattcgtatcatatagatccatggaatgaagctgagcct |
24831078 |
T |
 |
| Q |
110 |
taccctttctactagcgaatcggaacaaccattgaatgagagacaattttttcccccacagctgtatctgtatcatatgacatttgattttttcattgtc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831079 |
taccctttctactagcgaatcggaacaaccattgaatgagagacaatttttttccccacagctgtatctgtatcatatgacatttgattttttcattgtc |
24831178 |
T |
 |
| Q |
210 |
atgtccattggaagattcttcattaaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24831179 |
atgtccattggaagattcttcattaaat |
24831206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 85 - 153
Target Start/End: Original strand, 814968 - 815036
Alignment:
| Q |
85 |
agatccatggaatgaagctgagccttaccctttctactagcgaatcggaacaaccattgaatgagagac |
153 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
814968 |
agatccatgaaatgaaggtgagccttaccgtttctactagcgaatctgcacaaccattgaatgggagac |
815036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University