View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_65 (Length: 246)
Name: NF14034_low_65
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_65 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 51707247 - 51707475
Alignment:
| Q |
18 |
caactgtggcctttgatttgatgccacactctcggatgaatgaatatatgtttcttttcaaaataatatttcattttatagtcatacgttgtttacggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51707247 |
caactgtggcctttgatttgatgccacactctcggatgaaggaatatatgtttcttttcaaaataatatttcattttatagtcatacgttgtttacggaa |
51707346 |
T |
|
| Q |
118 |
aatcaactttttaaaccggcgttaacaaacttaaatttgtatccttgtttgcagnnnnnnnttgattttccataaacttttacactatgaagtataaaac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51707347 |
aatcaactttttaaaccggcgttaacaaagttaaatttgtatccttgtttgcggaaaaaaattgattttccataaacttttacactatgaaggataaaac |
51707446 |
T |
|
| Q |
218 |
tttaactttgtttatgcgctttaactttt |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
51707447 |
tttaactttgtttatgtgctttaactttt |
51707475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University