View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_71 (Length: 238)
Name: NF14034_low_71
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 42965199 - 42965411
Alignment:
| Q |
11 |
ataattaaataaatgtcttaattgcacttttgaccttattattttatcaaatttatgaaaatagtctcttttttnnnnnnnn--------ttgtatttta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42965199 |
ataattaaataaatgtcttaattgcacttttgacctcattattttatcaaatttatgaaaatagtctctttttaaaaataaaaaaaaaaattgtatttta |
42965298 |
T |
 |
| Q |
103 |
tggtccctctatcaaattaaaagttgcaattttaatcctaaatccccatatttctcctaaaaatggtgatttttgccgagnnnnnnnntgattcattgct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42965299 |
tggtccctctatcaaattaaaagttgcaattttaatcctaaatccccatatttctcctaaaaatggtgatttttgccgagaaaaaaaatgattcattgct |
42965398 |
T |
 |
| Q |
203 |
ccaatgttgaatc |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42965399 |
ccaatgttgaatc |
42965411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University