View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_78 (Length: 221)
Name: NF14034_low_78
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 71 - 125
Target Start/End: Original strand, 37464955 - 37465009
Alignment:
| Q |
71 |
caattttgtcaacaaagatttgcaagtgtcacgagctaccgtcgagcaacagttg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37464955 |
caattttgtcaacaaagatttgcaagtgtcacgagctaccgtcgagcaacagttg |
37465009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University