View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_85 (Length: 213)
Name: NF14034_low_85
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 3 - 199
Target Start/End: Complemental strand, 30567530 - 30567336
Alignment:
| Q |
3 |
gataattgaccgttggaatatctctcatattcagcaaataatattaaattattaaaacttaccaaaatcagctccttcactttctctataaacacctcac |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30567530 |
gataattgaccgttggaatatctctcatattcagcaaataatattaaattattaaaacttaccaaaatcagctccttcactttctctataaacccctcac |
30567431 |
T |
 |
| Q |
103 |
aaattcgaccgttataaacctaaaaactttctctctgtctctcccttttctctttcagagagagattcaccattttattcaacaacttcttcttctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30567430 |
aaattcgaccgttataaacctaaaaactttctctctgtctctcccttttctctttcaga--gagattcaccattttattcaacaacttcttcttctt |
30567336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University