View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14034_low_86 (Length: 212)
Name: NF14034_low_86
Description: NF14034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14034_low_86 |
 | |
|
| [»] scaffold0813 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0813 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: scaffold0813
Description:
Target: scaffold0813; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 4061 - 4242
Alignment:
| Q |
15 |
aatatcatttttactgcacgttgcaggtactatcatttattgtgatttgagtgcgacgtttgtgaacgttgaactctatttggtgtccttactacttgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4061 |
aatatcatttttactgcacgttgcaggtactatcatttattgtgatttgagtgcgacgtttgtgaacgttgaactctgtttggtgtccttactacttgtt |
4160 |
T |
|
| Q |
115 |
gtaggtgtgcatggttgtgggtgccttgcatacttatacatgcatctagaggatcttatgtgacctatgcaagaaagttcct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4161 |
gtaggtgtgcatggttgtgggtgccttgcatacttatacatgcatctagaggatcttatgtgacctatgcaagaaagttcct |
4242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 6617921 - 6617740
Alignment:
| Q |
15 |
aatatcatttttactgcacgttgcaggtactatcatttattgtgatttgagtgcgacgtttgtgaacgttgaactctatttggtgtccttactacttgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6617921 |
aatatcatttttactgcacgttgcaggtactatcatttattgtgatttgagtgcgacgtttgtgaacgttgaactctgtttggtgtccttactacttgtt |
6617822 |
T |
|
| Q |
115 |
gtaggtgtgcatggttgtgggtgccttgcatacttatacatgcatctagaggatcttatgtgacctatgcaagaaagttcct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6617821 |
gtaggtgtgcatggttgtgggtgccttgcatacttatacatgcatctagaggatcttatgtgacctatgcaagaaagttcct |
6617740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 63 - 161
Target Start/End: Complemental strand, 6526496 - 6526398
Alignment:
| Q |
63 |
gagtgcgacgtttgtgaacgttgaactctatttggtgtccttactacttgttgtaggtgtgcatggttgtgggtgccttgcatacttatacatgcatct |
161 |
Q |
| |
|
||||| |||||||||||| ||| |||||||||||||||||| ||||||||| |||||| |||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
6526496 |
gagtgtgacgtttgtgaaagtttaactctatttggtgtcctaactacttgtagtaggtatgcatgtttgtggctgccttgcatacttatacatgcatct |
6526398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 20 - 161
Target Start/End: Original strand, 6773274 - 6773414
Alignment:
| Q |
20 |
catttttactgcacgttgcaggtactatcatttattgtgatttgagtgcgacgtttgtgaacgttgaactctatttggtgtccttactacttgttgtagg |
119 |
Q |
| |
|
||||| ||||||| ||||| ||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||| || || ||| |
|
|
| T |
6773274 |
catttctactgcatgttgcgggtactaccatttattgaaatttgagtgcgacgtttgtgaacattgaactctatttggcgtccttactagtt-ttttaga |
6773372 |
T |
|
| Q |
120 |
tgtgcatggttgtgggtgccttgcatacttatacatgcatct |
161 |
Q |
| |
|
| |||||| |||||| ||||| |||||||||||||| |||| |
|
|
| T |
6773373 |
tatgcatgtttgtggcagccttacatacttatacatgtatct |
6773414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University