View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14035_high_15 (Length: 332)
Name: NF14035_high_15
Description: NF14035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14035_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 218 - 316
Target Start/End: Complemental strand, 45545056 - 45544958
Alignment:
| Q |
218 |
tacagaaaactactcactttgcatgttgctcgtgcaagatctgagcagcagattttgaaaccatgtccagcttcggcttcaaaacaatcccagcagtag |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545056 |
tacagaaaactactcactttgcatgttgctcgtgcaagatctgagcagcagattttgaaaccatgtccagcttcggcttcaaaacaatcccagcagtag |
45544958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University